Some key benefits of this kit are:
• Identification down to 10 copies of the target sequence
• Highly specific detection of Sendai virus and exogenous transcription factor genes in human iPSC
• Easier, faster, and more sensitive confirmation of Sendai virus-free iPSC clones compared to end point PCR
• Validated assays to ensure consistent performance
The TaqMan® iPSC Sendai Detection Kit is recommended for detection of Sendai virus and exogenous transcription factors (OCT3/4, SOX2, KLF4, and cMyc) in induced pluripotent stem cells generated with Sendai virus. The included TaqMan® assays can be used at different stages during reprogramming. They can be used 48 hours post transduction of Sendai virus to detect expression levels of exogenous transcription factors delivered by Sendai virus in the transduced cells. In addition, they can be used after the generation of iPSCs at different passages to determine the presence of Sendai virus. The TaqMan® primers and probes are specific for Sendai-delivered exogenous transcription factors and will not detect the corresponding endogenous factors. The TaqMan® iPSC Sendai Detection Kit is highly sensitive, specific, and enables real time monitoring of Sendai virus expression.
The 5 TaqMan® assays included in the kit are as follows:
| Assay ID | Target | Amplicon Length | Amplicon Context Sequence |
| Mr04269876_mr | Sendai-cMyc | 89 | GGGTGAATGGGAAGCGGCCGCATGC |
| Mr04269878_mr | Sendai-OCT3/4 | 82 | TCCCATGCATTCAAACTGACCGTAG |
| Mr04269879_mr | Sendai-KLF4 | 74 | CACATGAAGAGGCATTTTTAACCGT |
| Mr04269880_mr | Sendai | 59 | TGCCCCAAGCAGACACCACCTGGCA |
| Mr04269881_mr | Sendai-SOX2 | 62 | CACATGTGACCGTAGTAAGAAAAAC |
For Research Use Only. Not for diagnostic procedures.